Generative AI Digest: AI Drawn Into Geopolitics

While Anthropic's dispute with the Pentagon escalated over guardrails on military use, OpenAI LLC struck its own publicized ...

What most LLM apps get wrong about security

When Nandakishore Leburu was building LLM applications at LinkedIn, he learned that the models weren't the problem. The ...
CIO

Understanding tokenization and consumption in LLMs

At the core of these advancements lies the concept of tokenization — a fundamental process that dictates how user inputs are interpreted, processed and ultimately billed. Understanding tokenization is ...
How-To Geek on MSN

Why a Raspberry Pi is actually a terrible choice for a Plex server (and what you should use instead)

Raspberry Pis are not good for absolutely everything.
Marco Eagle

One python hunter dominates March competition for removing snakes

One python hunter, Anthony Flanagan, had a busy March eliminating the invasive snakes. He was rewarded by the South Florida ...
eLife

The Locomoting State Selectively Amplifies Activity of Sensitizing Neurons in Primary Visual Cortex

This manuscript presents a valuable analysis of how locomotion modulates the activity of different subtypes of cortical neurons in the mouse primary visual cortex, showing that locomotion more ...
eLife

Stimulus dependencies—rather than next-word prediction—can explain pre-onset brain encoding in naturalistic listening designs

The ability to predict brain activity from words before they occur can be explained by information shared between neighbouring words, without requiring next-word prediction by the brain.
Hackaday

Python Comes To The Arduino Uno Q

MicroPython is a well-known and easy-to-use way to program microcontrollers in Python. If you’re using an Arduino Uno Q, ...
Live Science on MSN

Hackers used Claude and ChatGPT to steal hundreds of millions of Mexican government records

A group of hackers used both Claude Code and ChatGPT in a cybersecurity hack that lasted two and a half months.
Nature

Neural encoding articles from across Nature Portfolio

Neural encoding is the study of how neurons represent information with electrical activity (action potentials) at the level of individual cells or in networks of neurons. Studies of neural encoding ...
AHA/ASA Journals

Targeting Interleukin-8–Mediated Cellular Crosstalk Reverses Hypertrophic Cardiomyopathy and Cardiac Fibrosis in Noonan Syndrome

BACKGROUND: Genetic variants in components or regulators of the RAS-MAPK signaling pathway are causative for severe and early-onset hypertrophic cardiomyopathy (HCM) in patients with Noonan syndrome ...
Nature

The gene encoding gigaxonin, a new member of the cytoskeletal BTB/kelch repeat family, is mutated in giant axonal neuropathy

A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...